Informace – DNA

pavelkabrt Genetika-teorie informace 0 Koment.

Původ na základě kauzality?

 Autor: Thel Thomas Akira
17.4. 2016


[Ilustrační foto, zdroj: www.redorbit.com]

Mnoho lidí z řad odborné veřejnosti se dnes domnívá, že informace obsažená v DNA je výsledkem čistě fyzikálně-chemických zákonů, neřízených sil a procesů, kde mechanismus variability, přírodního výběru (selekce) a mutace, zpracovávají, dokonce vytváří (!) genetický kód do smysluplné podoby významu a funkce.

Tento naturalistický koncept, bych chtěl spolu s vámi podrobit hlubší reflexi. Nakolik je tato hojně rozšířená teze udržitelná? Je z principu možné něco takového obhajovat z pozice metodologického naturalismu? Jaké důsledky vyvstávají přijetím těchto závěrů v dosavadním paradigmatu?

Upozornění: Vzhledem ke stručnosti obsahu článku se zde budou objevovat termíny, které svým obsahem nemusí být všem čtenářům zřejmé.

Úvod

Počátkem 40. let 20. století začali američtí vědci Edward Tatum a George Beadle tušit, že má informace v DNA ve formě genetického kódu souvislost mezi funkcí a tvorbou enzymů.[1] Za necelých 12 let vědci Watson & Crick rozluštili a popsali strukturu DNA, včetně úlohy jejího informačního obsahu.[2]

Dnes se ví, že informační hustota genomu je natolik vysoká, že jedna čajová lžička DNA by obsahovala údaje o 350x větším počtu lidí, než je současný počet obyvatel na naší planetě.[3] Učebnice „Molecular Biology of the Cell“ uvádí [4], že je tato informace stočená do buněčného jádra, a to takovým způsobem, jako kdybyste stočili 40 km tenkého vlákna do tenisového míčku, přičemž každá část by byla velice snadno přístupná k opravám a k replikaci. To není tak neúsporné řešení, pokud se DNA během průměrné délky lidského života s pozoruhodnou přesností zkopíruje asi 1016krát. [5] Vezmeme-li v úvahu, že kdyby se buňkám (např. bakteriím E. coli) dostalo neomezeného přísunu živin, stejně tak by nebyly ničím životně ohroženy, pak by za pouhé 2 dny byly 2 500x těžší, než je naše Země,[6] což je poměrně děsivá představa. Naštěstí je příroda stabilizovaná a precizně vyladěná tak, že nedochází k extrémním populačním výkyvům.

DNA je nositelkou neobyčejně složitých informací. „Forma zápisu genetických informací byla odhalena u tzv. strukturálních genů.* Tyto geny jsou nositelem informace pro počet a pořadí aminokyselin v určitém polypeptidickém řetězci…“ [7] Podle novým zjištění projektu ENCODE, DNA ve skutečnosti užívá 2 úrovně programovacího jazyka! [8]

* Pozn.: pouze 1,5 – 2 % DNA lidského genomu se bezprostředně podílí na expresi strukturálních genů (viz ilustrace). Zbylou většinu tvoří sekvence – instrukce, řídící metabolické pochody, biochemické reakce, transport látek, signalizační kaskády, transkripci, uskladnění energie za pomocí ATP, opravné mechanismy atd. atd. To vše ve vhodný okamžik, ve správném pořadí a na správném místě.

Popis: vysoce složité trojrozměrné bílkovinné struktury motoru bakteriálního bičíku, vzniklé prostřednictvím genové exprese a prostorových (matematických) algoritmů.


Zdroj ilustrace: http://jb.asm.org/content/191/16/5026/F4.large.jpg]

[Pozn.: Na levém sloupci ilustrace (A, B, C a D) jsou představeny díly elektromotoru vyrobené člověkem v současnosti. Na druhé straně ilustrace jsou organické supramolekulární části motoru bakteriálního bičíku na bázi protonů. Hnací hřídel spolu s hybnou sílou vodíkových iontů mu dodávají rychlost až 100 000 otáček za minutu [9], přitom mu stačí přibližně čtvrtina otáčky k zastavení, aby mohl opět točit 100 000 otáček na druhou stranu. [10] Prof. Haward Berg z Harvardské univerzity ho označil za nejvýkonnější stroj v celém známém vesmíru. [11] Pro představu: bakterie E. coli se 6 elektromotory o otáčkách 6 000/min se v našich poměrech pohybuje ve vodě rychlostí cca 400 km/h. [12] Tento charakteristický znak pohybové soustavy jednobuněčných organismů (prokaryot) zde přebývá od raného období „vývoje“ života. Organické komponenty svými specifickými rysy i účelem proto nápadně připomínají konstrukční prvky.]

Položme si základní otázku: Jaký je původ této vysoce složité informace? Lze původ informačního obsahu vyvozovat ze samotného materiálního nosiče (DNA), a hledat její sémantický aspekt ve vlastnostech hmoty, jež je uspořádána fyzikálně-chemickými zákony?

Veškerý softwarový svět užívá klasickou dvojkovou soustavu – binární kód, díky němuž vyjadřujeme širokou škálu kombinací a jsme schopni jakoukoliv informaci, jakékoliv sdělení vyjádřit pouze na základě jedniček a nul.

010100101011010110010101110101010010001011011100010101000
111001010101100100010110111000101010101011010010101101011
00101010101001000…
[Ilustrační příklad sady znaků binární soustavy]

DNA užívá nikoliv binární, ale kvartérní soustavu. Sekvence nukleotidů (nukleových bází): adeninu (A) – guaginu (G) (tzv. puriny), a thyminu (T) – cytosinu (C) (tzv. pyrimidiny), tvoří základ genetické informace. „Na každé nukleotidové pozici se nachází jedna ze čtyř bází (A, C, T a G), což znamená, že sekvence o délce n může nabývat 4n stavů.“ [13]

ATCCTAACTAGCAATACCCAATACCAGGAGCATACCAATAGACTAGCATACCAACTAG
CATACCACCCAGGACTAGCAATCGCAGTCCAATACCAAATAGACTAGCATACCAAAG…

[Ilustrační příklad kvartérní soustavy sady znaků DNA]

Tímto genetický kód ze své podstaty disponuje daleko větším a nepředstavitelně obrovským množstvím kombinací. Máme-li např. nejmenší genom organismu s počtem 159 662 bází (Carsonella Ruddii, pozn.: jeden z nejmenších genomů organismů, jaký kdy byl objeven [14]), pak sada kombinací nabývá 4159 662 znaků!!! (Počet všech elementárních částic v celém známém vesmíru se odhaduje asi na 1080. [15])

Nejen, že se jedná o absurdní číslo, se kterým neoperuje ani teorie superstrun, nýbrž dalece přesahuje hranice jakékoliv myslitelné představy. Co teprve genom běžných eukaryotních organismů nebo savců jako je člověk (3,2 miliardy bází)? [16]

Máme tedy prakticky nekonečné množství sady znaků. Co to vlastně znamená? Písmena A-G a T-C sice utvářejí páry v dvoušroubovici (di-helixu) DNA, prostřednictvím vodíkových můstků, ale uspořádanost mezi jednotlivými „písmeny“ na jednom ze dvou vláken (helixu), jež přesně určují instrukce pro stavbu biologických makromolekul, složité terciální bílkovinné struktury nebo prostorové matematické algoritmy, není dána na základě samotných vlastností bází*, protože počet nahodilých uspořádaných kombinací n-stavů bází je – jak jsme si ukázali – prakticky „nekonečný“. A jen malá část sady znaků dává účel a smysl.

Jiný příklad.: Představte si obyčejnou sklenici vody a kostku cukru, která se v ní následně rozpustí.
Otázka: Jak lze odvodit z rozptýlených molekul cukru ve vodě jejich původní formu (tj. formu kostky), před vhozením do sklenice?

*pozn.: mezi jednotlivými bázemi totiž působí např. slabé Van der Waalsovy síly

Věda může popisovat, jak probíhá difúze mezi molekulami vody a cukru (H2O a C12H22O11), může popisovat složení vody a cukru, je schopna určit optickou aktivitu a izomerii obsažených organických látek, je schopna popsat chemickou a fyzikální strukturu sklenice, ve které se nachází voda s cukrem atd., ale otázka typu: Jak lze z rozptýlených molekul cukru ve vodě odvodit jejich původní formu před vhozením do sklenice? je otázka zcela mimo rámec operační vědy, inklinující spíše k otázkám filosofie.

Na základě fyzikálně-chemických vlastností cukru, který se rozpustil ve vodě, nelze a není možné odvozovat jeho původní tvar (kostku), protože ten může nabývat prakticky „nekonečných“ množství podob (řešení).

Jiný příklad: Když se podíváme na stránku tištěného textu knihy. Vidíme, že text dává smysl. Každé jednotlivé písmeno (znakové abecedy, ať již české nebo jakékoliv jiné) je uspořádáno tak, že dává význam jednotlivým celkům, jako jsou slova, věty, odstavce, stránky, popř. celé kapitoly. Evolucionista Dr. Ridley zde shledává úzkou analogickou souvislost mezi nosičem informací DNA a tištěným textem:

Myšlenka o genomu jako knize není, v pravém slova smyslu, ani přirovnáním. Je to doslovná pravda. Kniha je kusem digitální informace… Stejně tak genom.“ – [17]

Otázka: Je determinován sémantický aspekt informace v podobě písmen a celých vět vazebnými interakcemi inkoustu a papíru?

Ještě jinak: Čím je určen smysl obsahu textu, který právě nyní čtete? Z hardwarového nosiče? Ze softwarového vybavení PC platformy? Vždyť to jsou jen data! Sémantická informace se z nich stává až po předešlém přiřazení významu a účelu funkce. Obyčejná věta: „Dobrý den!“ může být klidně stanovena kódující binární sadou znaků: 0100101011101, nebo: 011101111111, nebo: 000000001111, nebo: 1111111110000 … jakoukoliv kombinací. Možností schopnosti vyjádření je nekonečně mnoho. Na čem tedy závisí jejich význam a jejich účel??

Na dohodě! V prve řadě. Jenže dohoda je ze své podstaty záležitost čistě kreační, inteligentní, nemateriální, chcete-li duchovní. Materiál, nebo-li nosič je až sekundární složkou, stopou, odkazem této inteligentní, bezrozměrné veličiny.

Ve chvíli, kdy v podobě libovolné sady kódu stanovíme určitý univerzální komunikační jazyk, pak jím prostřednictvím materiálního nosiče můžeme samozřejmě vyjádřit ohromné množství sdílené informace, ale to také znamená, že z nekonečně možných kombinací jsme si vybrali jen úzký prostor, poskytující význam a smysl. Stojíme tak na nezměrné, nepředstavitelně hluboké propasti bezvýznamných na jedné straně, a smysluplných forem znaků na straně druhé.

Uvedená otázka proto nemůže být nikdy z principu kladně zodpovězena. Neboť z matematického hlediska existuje nekonečně mnoho řešení, které UMOŽŇUJÍ* množství kombinací způsobu vazebné interakce inkoustu a papíru.

Informace v DNA představuje tentýž matematický problém, pouze malá část kombinací nukleotidů umožňuje správné využití proteinů i aminokyselin do kompletní funkční podoby fenotypu. Na druhé straně existuje obrovské, daleko vyšší množství kombinací, které nic smysluplného neposkytují (nekódují), nýbrž představují pouhý „informační šum“. Složitost astronomických čísel je tak zřejmá u bílkovin „ve kterých se pravidelně vyskytuje cca 20 aminokyselin, přičemž za vzniku dipeptidu mohou zreagovat libovolné dvě aminokyseliny. Pokud tedy průměrná bílkovina obsahuje asi 100 aminokyselinových zbytků, může vzniknout až 20100 (tj. 1,2 . 10130) jedinečných polypeptidů dané délky. Příroda však vytváří jen nepatrnou část z celého možného množství bílkovin.“ [18]

Jestliže vědci popisují živou soustavu, jsou schopni určit, jaká je její energetická soustava, z jakých druhů aminokyselin je vytvořena, jaké biochemické reakce probíhají v jejím metabolismu, jaká je její fyziologie, kolik zpracuje informací atd., ale ve chvíli, kdy vyvstane otázka:

Jak lze odvodit původ informace DNA (sémantický aspekt informace) na základě samotných základních stavebních organických jednotek (tj. nosiče: deoxyribózy, cukru, nukleové báze a fosfátové skupiny), než se objevil život v podobě, jakou známe nyní? Je otázka dílem z oblasti filosofie – metafyziky a dílem z oblasti biologie – bioinformatiky. A tak „mezi hmotným nosičem a genetickým kódem není žádná příčinná souvislost, jedno není příčinou druhého.“ [19]

Závěr

„Nyní by mělo být jasné, že informace, jakožto fundamentální entita, nemůže být záležitostí vlastností hmoty, a její původ nemůže být vysvětlován z hlediska materiálních procesů.“ – [20]

Prof. Dr. Werner Gitt – informatik

* Pozn.: Fyzikálně-chemické vlastnosti umožňují vazebnou interakci inkoustu s papírem, ale v zásadě neurčují/nespecifikují podobu smyslu textu, možností je nespočet (umožnit a zapříčinit není jedno a totéž!). Jestliže prohlásíme, že smysl textu je výsledkem toliko chemické vazby, interakce inkoustu a papíru, pak se blížíme nalezení podstaty problému, odpovídajícím způsobem asi stejně jako výrok: „Hora Mount Everest se nachází někde v části vesmíru.“ Z téhož důvodu abstrakce nelze přistupovat k informaci, zaznamenané v DNA.

Příloha – nárůst informační komplexity DNA
fundamentální úskalí evoluční teorie?

Začněme hned hlavní otázkou:

Jak si evolucionisté představují postupný kumulativní nárůst informační komplexity, tj. bohatosti genofondu prvotních organismů do taxonomicky vyšší kategorie živočichů a rostlin v pozorované současné diverzitě?

Tento výchozí předpoklad neodarwinismu – zdá se – měl být evolučními vědci zodpovězen od samotného začátku objevení deoxyribonukleové kyseliny (DNA), co by základu života a nositelky veškeré dědičné informace. Existují 3 navrhované modely neodarwinismu [21] :

1. V sekvenci nukleotidů může být jedna báze nahrazena jinou.
2. Sekvence bází DNA je zduplikována.
3. Ve zduplikované sekvenci došlo ke zlepšující změně, z jedné biologické funkce (fitness) organismu k druhé.

Příklad: Vezměme si zmíněný nejjednodušší známý organismus (pozn.: „nejjednodušší“, co se týká množství celkového souboru genetické informace) – Carsonella Ruddii o řadové délce cca 159 662 párů bází (bp).[22] Pro naši představu je to asi 88 stránek formátu A4, popsaného sadou znaků genetické informace. Tyto geny postrádají patřičné funkce pro základní biologické buněčné procesy (replikace, transkripce, syntéza některých proteinů a bílkovin). Samotný život tohoto drobného organismu je udržován endosymbiózou, v hmyzu mery – (Pachypsylla venusta).[23]

Pokud by trend kvantitativního snižování genetické informace měl pokračovat, zřejmě bychom se dostali k jednoduché formě genomů, podobné u virů. Ale má to háček, jak víme, viry nejenže se liší genetickou stavbou (uracil nahrazuje thymin), jsou především jakkoliv neschopny nezávisle na hostiteli vlastní replikace i reprodukce. Limit soběstačnosti je proto ohraničen počtem genů schopných vlastní, nezávislou životaschopností a reprodukcí organismu. Bude-li někdo prohlašovat, že jeden z prvotních jednoduchých organismů po vzniku života na Zemi obsahoval sadu genů pro autoreplikaci nebo reprodukci, měl by pochopitelně doložit, kolika nezbytně nutnými geny je takový biologický cyklus realizován. Pokud vůbec bude schopen předložit nějaké, pozorováním/experimenty ověřitelné číslo, evoluční „mystery of life“ začne být teprve zajímavá:

Ponořme se do říše ničím neověřených spekulací a vyslovme tezi, že velmi jednoduchý, primitivní, soběstačný*, reprodukční organizmus obsahoval min. 100 genů, přičemž průměrný gen by obsahoval asi 900-1 000 nukleových bází. Pro představu: Je to asi 50 stran nahuštěného textu v podobě sady znaků genetické informace, ve formátu A4, viz následující ilustrace:

[Ilustrační příklad jednoho genu. Nyní si to vynásobte 100x]

informace_-_dna_4-ilustracni_obrazek_tripletu_0.jpg

Každý z těchto kodonů (tripletů), kóduje pro organismus složité, životně důležité stavební aminokyseliny a proteiny. Pojďme postupovat dále:

1. V sekvenci nukleotidů je např. jedna báze nahrazena jinou.

Při adici nebo deleci páru bází budou mít všechny následující triplety změněný smysl:

AGA/GCA/ATC/CTA/ATA/GCA/ATA/CCA/…

(pozn.: sekvence tripletů před adicí)

Po adici (např. guaginu-G ) v první pozici:

GAG/AGC/AAT/CCT/AAT/AGC/AAT/ACC…

* Pozn.: Soběstačný organismus by měl obsahovat daleko více genů, ale na druhou stranu evoluční teorie vyžaduje jednodušší formu.

Všimněte si, že se posune čtecí rámec, proto se také logicky začnou sestavovat úplně jiné druhy aminokyselin. To znamená, že výsledný polypeptidický řetězec, kódován úsekem cistronu (tj. úseku sekvencí tripletů, kódujících aminokyseliny do proteinů) je úplně změněn. Co se stane, až se takový polypeptid v endoplasmatickém retikulu (chaperony) začne prostorově skládat, prostřednictvím speciálních instrukčních algoritmů do základních forem proteinů? Nebo, co by se stalo, kdyby se změnily samotné algoritmy? Je pak vůbec možné hovořit o výstavbě vysoce složitých, kvartérních a terciálních bílkovinných struktur? Nemluvě o tom, že DNA užívá 2 úrovní programovacího jazyka [8], nikoliv pouhou expresi genů pro fyziologickou výstavbu těla organismu. A tak závažnost situace můžeme shrnout takto:

Je zřejmé, že i při normální kombinaci dalších tripletů bude podstatně změněn celý smysl informace a při postižení většího úseku informace (pokud polypeptid vůbec vznikne), bude tato informace zcela odlišných vlastností. Tyto „molekulární“ změny podmiňují mutace, které mají za následek neaktivní enzym, chybění enzymu, polypeptidu apod.“ – [24]

V našem případě se jednalo o mutaci typu frame-shift. Pokud organismus přežije, nebo dojde ke změně sekvencí DNA (např. kódující složité metabolické pochody, umožňující trávit místo cukru citrát, viz Lenskiho experiment), lze hovořit o neuvěřitelném štěstí, ohraničeném výsledkem adaptačních mechanismů a sofistikovaného vybavení JIŽ EXISTUJÍCÍHO(!) genofondu organismu. Co se ale stane, pokud budou následovat další kroky nahodilých mutačních změn v DNA? Opět se změní celý smysl a je jisté, že organismus zahyne.

Evoluční teorie ovšem předpokládá, že takových*, po sobě jdoucích, životaschopných kroků muselo být nespočet. Obdobně postuluje, že se všechny tyto genetické znaky rozšíří v populaci, a přeživší potomstvo nebude nijak sterilní. Taktéž postuluje, že selekční tlak na organismus probíhá kontinuálně. Ale poněvadž je v proměnlivém tlaku přirozeného prostředí, z praktického hlediska je něco takového vyloučeno, organismus po změně selekčních tlaků inklinuje do zpětné (původní) formy fitness funkce, (viz Flégrova „plasticita“ zamrzlé evoluce).

*Pozn.: Pokud bychom zvažovali jinou formu evolučních mechanismů, např. „substituci“ sekvencí, problém by se nijak nezmenšil. Např. na šesté pozici beta-řetězci genu pro hemoglobin je zaměněn Valin místo kys. glutamové, což způsobuje srpkovitý tvar červených krvinek (viz srpkovitá anémie). Jedinci jsou sice odolnější vůči malárii, avšak za cenu nízkého průměrného věku dožití, nedostatečného okysličení organismu, nesprávné funkce oběhového systému atd. atd.). Pokud by k tomuto hnacímu mechanismu mělo nadále docházet, lze s největší pravděpodobností konstatovat, že dopady na zasaženou populaci budou nepříznivé, karcinogenní až letální.

Bezpochyby kvantitativně, již nikoliv kvalitativně. Gen zase vzniká z genu (J. Flégr – Evoluční Biologie, s. 201, v nových 203). Pokud by došlo ke zduplikování určitých sekvencí bází v DNA, znamenalo by to, že nadbytečné kopie začnou nadbytečně produkovat bílkoviny, čímž zákonitě dojde k narušení správné hladiny rovnováhy koncentrace bílkovin v těle organismu. Je otázkou, které další aktivátory a RNA mechanismy budou tuto část zduplikovaného genu „obsluhovat“ ve správný čas, ve správném pořadí a na správném místě. Navíc, jak víme, že takový zduplikovaný gen zůstane aktivován? Proč by si přírodní výběr pracně hromadil a kumuloval nepotřebný materiál??

V drtivé většině případů nekumuloval/nehromadil (proč taky?), zduplikovaný gen zůstává inaktivován a rychle mizí z populace. Představa toho, že by v každé sousledné generaci došlo k jeho fixaci, patří opět do říše neudržitelných mýtů.

3. Ve zduplikované sekvenci došlo ke zlepšující změně z jedné         biologické funkce (fitness) organismu do druhé.

Pozitivní mutace“ je silně matoucí pojem, neboť více, než 99,9 % všech mutací jsou negativní, ztrátové, zbylé desetiny procenta možno označit za latentní/neutrální či vzácně: „pozitivní*. Jak rychle se v neodarwinistickém konceptu zduplikuje jeden gen? Podle odhadů asi 100 genů za 1 milion let. [25] To je příliš velký časový prostor pro působení mutagenních procesů (ionizující záření, chemomutageny, transposony aj.), mající za následek ztrátu biologické funkce, popř. deaktivaci genu. Když se podíváme [26] na analýzu dat sekvenování současných genů, ať již u rostlin nebo jen u některých živočichů, vyvstávají zde obrovské disproporce: Např. Prutovka nahá (Psilotum nudum) je mnohem daleko jednodušší, než rostliny z rodu huseníček (Arabidopsis thaliana) a přesto má až 3 000x větší genom. Bahník (aethiopicus), ryba žijící v deltách řek má cca 40x větší genom ve srovnání s člověkem, a přesto nikdo netvrdí, že by v evolučním vývojovém stromu zaujímala vyšší postavení.

Bakterie z kmene Firmicutec (Epulopiscium fishelsoni) obsahuje 85 000 zduplikovaných genů. [27] Tyto geny nenesou žádné stopy, ba ani náznaky, že by se v průběhu evoluce, kdy chystaly podstoupit jakékoliv komplexnější změny. Čelíme tak nebývalému chaosu, který je velmi nedostatečně vysvětlován standardními evolučními předpoklady a procesy.

* Pozn.: „pozitivní“ – dočasně nebo na úkor jiných korektně optimalizovaných funkcí. V obou kategoriích vznikají znaky degenerativního charakteru se sníženou bohatostí genofondu.

Závěrem si proto položme klíčovou otázku:

Jak si zastánci evoluční teorie na jednoduché analogii [17] 55 stránkového textu představují nárůst smysluplných informačních dat, do např. 250 svazků? Jak dochází k postupnému, kumulativnímu, kvantitativnímu i kvalitativnímu nárůstu bohatosti genofondu prvotních organismů do taxonomicky vyšších kategorií živočichů a rostlin? Jaké jsou vědecky prokazatelné důkazy a experimentálně ověřitelná fakta tohoto základního kamenu evoluce?

…a je tento „kámen“ evoluce vůbec podložen?

[Použitá literatura a odkazy]

[1] – HART-DAVIS, Adam a kol.: „Věda“, 1. Vydání. Praha: Euromedia Group, k. s. – Knižní klub, 2011, s. 348, ISBN 978-80-242-3078-8 [2] – Nobel prize – Lotta Fredholm: „The Discovery of the Molecular Structure of DNA – The Double Helix“: http://www.nobelprize.org/educational/medicine/dna_double_helix/readmore… [3] – ILIC, B. – YANG, Y. and col.: Nano Letters: „Enumeration of DNA Molecules Bound to a Nanomechanical Oscillator“, Vol. 5, n. 5, 2005, p. 925 [4] – ALBERTS, B. – JOHNSON, A. and col.: „Molecular Biology of the Cell.“ 4th edition. New York: Garland Science; 2002: http://www.ncbi.nlm.nih.gov/books/NBK26834/ [5] – ULMSCHNEIDER, P.: „Inteligent Life in the Universe“ 2nd edition, Springer: 2006, p. 125: http://www.e-reading.biz/bookreader.php/135157/Intelligent_Life_in_the_U… [6] – MARTIN , W. F. – MULLER, M.: „Origin of Mitochondria and Hydrogenosomes“, Springer-Verlag: 2007, p. 21, ISBN-10 3-540-38501-1 [7] – ČERNÝ, M.: „Lékařská genetika“, Státní zdravotnické nakladatelství, Vydání první Praha 1967, s. 28 [8] – SEILER, S.: „Scientists discover double meaning in genetic code“, UW Health Sciences & UW Medicine,“ Dostupné online, Dec 12, 2013: http://www.washington.edu/news/2013/12/12/scientists-discover-double-mea… [9] – ASM Microbel Library: MELLIES, „J.: Bacterial Flagella Stain Protocol“ – 2008: http://www.microbelibrary.org/component/resource/laboratory-test/3153-ba… [10] – Creation-magazine: STEVEN, D.: „The Amazing Motorized Germ“ – 2004: http://www.answersingenesis.org/articles/cm/v27/n1/germ [11] – Media in Corporated: „What Darwin Didn´t know„: http://www.mediaincorporated.com/html/sg_darwin.html [12] – GITT, Werner and K.-H.Vanheiden, „If Animals Could Talk“; CLV 1994,
New Jersey, p. 86, ISBN 0-87213-225-0. [13] – MARATHE, A.; CONDON, A. E.; CORN, R. M.: „On combinatorial DNA word design.“ J Comput. Biol. 2001, roč. 8, čís. 3, 201-19, dostupné online: http://www.ncbi.nlm.nih.gov/pubmed/11535173

Překlad: https://cs.wikipedia.org/wiki/DNA#cite_note-52

[14] – BALL, P. – Nature: „Smallest genome clocks in at 182 genes“, 2006: http://www.nature.com/news/2006/061009/full/news061009-10.html [15] – MASTIN, L. – The Physis of the Universe: „The Universe by Numbers“: http://www.physicsoftheuniverse.com/numbers.html [16] – KIMBALL, J. W. – Biology Pages: „Genome Sizes“, 2013: http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/G/GenomeSizes.html [17] – RIDLEY, M.: „Genom – Životopis lidského druhu v třiadvaceti kapitolách“, 1. vyd., přeložil Ivo Muller, Portál, Praha 2001, s. 12 [18] – JESO, P.: „Štruktúra bielkovín“: http://www.bio-che.szm.com/bielkoviny2.htm [19] – VOTOČEK, L. – Cep: „Petr Hájek: Já z opice nepocházím“, 2009: http://cepin.cz/en/diskuse.php?ID=896&typ=CL&vlozit=0 [20] – GITT, W.: „In the beginning was information.“ 2nd English edition: CLV, 2000. 256 p. ISBN 3-89397-255-2. [21] – Pozn.: Tyto návrhy byly sestaveny na základě podnětu (evolucionisty), Mgr. Michala Hanka. [22] – TAMAMES, J. at. all.: „The frontier between cell and organelle: genome analysis of Candidatus Carsonella ruddii“, publikováno online, 2007, Oct: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2175510/ [23] – MicrobeWiki, dostupné online, 3 Sept. 2010: https://microbewiki.kenyon.edu/index.php/Candidatus_Carsonella_ruddii
BANASZEK, T.: „Carsonella ruddii“, Missouri University of Science and Technology: http://web.mst.edu/~microbio/bio221_2007/C_ruddii.htm [24] – Viz: ČERNÝ, M.: „Lékařská Genetika“, s. 59. [25] – LYNCH, M. a CONERY, J. S.: „The Evolutionary Fate and Consequences of Duplicate Genes.“ Science (2000), 290: 1151-1155. Dostupné online: http://www.ncbi.nlm.nih.gov/pubmed/11073452 [26] – „Genome Sizes“, Dostupné online – 3 Apr 2016: http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/G/GenomeSizes.html [27] – Microbial Classification: „A brief introduction to the diversity of the microbial world.“ Dostupné online (4 apr., 2016): http://microbialclassification.blogspot.cz/p/bacteria.html
Share on FacebookShare on Google+Tweet about this on TwitterShare on LinkedInEmail this to someonePrint this page

Komentujte

Buďte první kdo bude komentovat!

Upozornit na
wpDiscuz