Další odpadní DNA jde do odpadu, kde už je celá evoluční teorie

pavelkabrt Genetika-teorie informace 0 Koment.

Podle informací z několika odborných článků zpracoval Pavel Kábrt – 6/2016

„Evoluční teorie je ideologický mýtus, vydávaný už 150 let za vědu. Otcem tohoto mýtu je svévolné zacházení s fakty, jeho matkou je ohromná kupa neznalostí, lží a omylů uvnitř Darwinovy darebácké party.“ Pavel Kábrt

Každý, kdo se jen trochu zajímá o kreacionismus a evoluční teorii ví, jak evolucionisté 40 let, vedle kupy dalších svých nesmyslů a omylů, propagovali jako „velký důkaz evoluce“ existenci tzv. odpadní DNA (junk DNA) – tedy ty úseky DNA, které nekódují proteiny a u nichž neznali (a často dosud neznají) funkci – a tak snadno a rychle došli ke zbrklému ideologickému závěru, že zde žádná funkce není a jde jen o zbytečný pozůstatek evoluce např. v lidském genomu, a nazvali to „odpadem či haraburdím“ a podobnými, Boží stvoření dehonestujícími termíny.1 Na našem webu je o tom řada článků (zde a zde a zde a jinde) a proběhla o tom také zuřivá diskuze, kdy se někteří evolucionisté „odpadní DNA“ nechtěli a dosud nechtějí za nic na světě vzdát a uznat svůj omyl. Oni totiž „odpad“ v genomu potřebují, aby jím prokazovali milióny let trvající bezcílnou evoluci. Zamotal se do toho i známý evoluční biolog Dawkins a zatloukal a zatloukal. Změnu v poznání odstartoval projekt ENCODE (v červnu 2007 byly publikovány výsledky v časopisu Nature), mnozí evolucionisté, jak jsem řekl, se však výsledkům tohoto výzkumu brání dodnes. Tak to dělají vždy, když fakta nezapadají do evomýtu.

Jak se nyní dozvídáme, mylný koncept odpadní DNA je znovu odhalován novými výzkumy a dalšími poznatky z oboru genomiky. Opakující se „slova“ v DNA sekvencích tvoří více jak polovinu lidského genomu, který se skládá asi ze tří miliard nukleotidů2. My lidé běžně usuzujeme, že když se něco v naší řeči opakuje, bývá to chyba a můžeme to snadno označit za nesmysl třeba v psaném textu. Tak se dlouho domnívali i evolucionisté, že opakující se sekvence v lidské DNA, jejichž význam neznali, je taková nepotřebná zátěž, kterou si lidský genom s sebou nese po miliónech let údajné evoluce kopírování a duplikací genů. Teď se ale ukazuje, že nic nemůže být vzdálenějšího pravdě než tento omyl, protože opakující se sekvence jsou spojeny se vše prostupujícími biochemickými funkcemi.

Jedna taková skupina opakujících se částí lidské DNA se nazývá tandem repeats (TRs – tandemové repetice). Jsou to vlastně jednoduché úseky DNA tvořené dvěma nebo více při sobě ležícími kopiemi tvořícími „slovo“ (což se nazývá motif – motiv). Tyto úseky jsou určitým způsobem orientovány, směrovány. Můžeme si uvést takový příklad repetitivního úseku: „ttacttacttacttacgttac“. Opakuje se zde základní motiv o čtyřech bázích „ttac“, a opakuje se pětkrát. Je to velmi udivující, ale právě tyto TR motivy se nacházejí v celém lidském genomu. Nejen uvnitř genů, ale i mimo ně, a dokonce je nacházíme i v genech kódujících proteiny. U lidí se tyto TR motivy liší délkou opakování. Forenzní věda je využívá jako velmi účinný nástroj DNA markerů k rozpoznání kriminálních činů nebo v případech určování paternity (otcovství). Z čisté neznalosti „naházeli“ evolucionisté všechny tyto úseky DNA „do svojí evoluční popelnice pro zbytečný odpad“. Jen pro zasmání: naházeli tam asi 95 % celého genomu! Kdyby evoluční teorie nebyla taková tragedie, byla by to docela humorná fraška a evolucionisti by mohli být považováni za profesionální kašpary. Kéž by byli jen kašpary!

Nebylo to v důsledku evoluční „vědy“, plné stále se měnících příběhů, pohádek a fantazií, ale v důsledku skutečné vědy tvrdých faktů, proč vědci začali přemýšlet o možnosti nějakého smysluplného významu těchto TR repeticí. Vymysleli řadu experimentů, aby TR motivy otestovali, zda nemají nějaký svůj význam v genové expresi a v epigenetické modifikaci DNA. O epigenetické modifikaci už jsme na tomto webu psali, že jde o určité markery v genetickém zápisu, které neovlivňují vlastní skladbu sekvence nukleotidů, a přesto nesou velmi významný informační smysl (zapínají či vypínají geny, například). Epigenetika je v silném rozporu s klasickou darwinistickou evolucí formou mutace-selekce, a jak tedy jinak, mnozí evolucionisté proto epigenetiku „nesnášejí“ (např. Richard Dawkins).3 Málokdo ví, že krátce po Darwinovi se evolucionisté stavěli proti genetice jako takové (to už dnes zatloukají), protože výzkumy Gregora Mendela silně protiřečily (a stále protiřečí) evoluční doktríně. Fakta je však nakonec donutila nějak to vzájemně sladit.4

Po rozsáhlých vědeckých testech se došlo k závěru, že „…výsledky naznačují, že existují potenciálně tisíce různých variant TR v lidském genomu, které vykazují funkční dopady tak, že mění expresi místního genu nebo epigenetické účinky.“ Dále byla také potvrzena souvislost mezi TR a lidskými nemocemi. Desítky lidských dědičných onemocnění jsou přímo spojeny s velkými repetitivními úseky, a to jak v nekódujících oblastech genomu, tak i v oblastech, které kódují proteiny.5 Je zřejmé, že tyto motivy jsou pod přísnou kontrolou genů, a pokud se této kontrole vymknou a například změní nekontrolovaně svoji délku, výsledkem může být nemoc.

Zde máme tedy znovu zářný příklad toho, jak evoluční pavěda škodí vědeckému výzkumu paličatým lpěním na evomýtu, že organizmy vznikly jen tak samy od sebe jakousi bájnou evolucí. Stačí, aby evolucionista něčemu nerozuměl a neznal příslušnou funkci, a už to s nadšením prohlásí za organizmu „nepotřebné“ a důkaz bezcílné evoluce. Kdyby místo evoluční hypotézy aplikovali vědci při svém výzkumu kreacionistické hledisko, že Bůh vše stvořil s určitým účelem a smyslem a funkcí, vědecký pokrok (třeba i ve výzkumu nemocí) by byl mnohem rychlejší, protože by nebyl brzděn mylnou hypotézou s kupou omylů a hlavně špatných předpokladů. Místo toho, aby evolucionisté zkoumali funkci a význam repetitivních TR úseků DNA, jako to dělají kreacionisté, tak tyto úseky „hodí do odpadu“ a prohlásí za důkaz evoluce. 40 let tak byla věda v oblasti smyslu a funkce nekódujících genů na mrtvém bodě díky tomuto mylnému evolucionistickému dogmatu. Kdyby toto byla jen jediná škoda, kterou má evoluční báchorka na svědomí, byla by to jen úsměvná epizodka. Milióny mrtvých v přímém důsledku Darwinova nesmyslu by však mohly vyprávět!

Odkazy

1) Evoluční teorie je ideologický hnůj, který během svého 150tiletého prznění vědy nakydali Darwinovi darebáci na klenot Božího stvoření (Pavel Kábrt) Zpět na 1
2) Quilez, J. et al. 2016. Polymorphic tandem repeats within gene promoters act as modifiers of gene expression and DNA methylation in humans. Nucleic Acids Research. 44 /8/: 3750-3762. Zpět na 2
3) Epigenetika-impozantní odmítnutí evoluce, Proč tedy Dawkins odmítá nejen epigenetiku, ale i ostatní nové směry? (Proč jsme na světě) Zpět na 3
4) „Když byly znovuobjeveny Mendelovy zákony a vznikla genetika, evolucionisté se pokusili Mendela s Darwinem skloubit…“ – Jaroslav Flegr Zpět na 4
5) Gemayel, R., M. D. Vinces, M. Legendre, and K. J. Verstrepen. 2010. Variable tandem repeats accelerate evolution of coding and regulatory sequences. Annual Review Genetics. 44: 445-477. Zpět na 5

Share on FacebookShare on Google+Tweet about this on TwitterShare on LinkedInEmail this to someonePrint this page

Komentujte

Buďte první kdo bude komentovat!

Upozornit na
wpDiscuz